top of page

Lesson 6

Central Dogma

Now that we have learned foundational material in Module 1, we now going to move on to learn more specifically about proteins in Module 2. However, before we can discuss the structure and function of proteins, we need to discuss how proteins are made in the cell.

​

The central dogma of molecular biology explains how DNA codes for RNA which in turn codes for a protein. Watch this video which explains the central dogma.

CentralDogma.png

[1]​

​

Transcription

In the first step, DNA is transcribed to RNA. RNA polymerase uses a single strand of DNA to synthesize a complementary strand of RNA. There are many types of RNA which we will not get into here, but the type of RNA which eventually codes for protein is called messenger RNA or mRNA. Read this Kahn Academy lesson on the details of transcription. 

​

Q1: What is different about RNA bases vs. DNA bases? (this should be review!)

​

Throughout this tutorial we will be working with lipoprotein signal peptidase (LspA) protein. The beginning of LspA's DNA sequence is: 5'- ATGCCGGATGTG -3'

​

Q2: What is the mRNA sequence made from this DNA? (Hint: remember the direction RNA is made)

Translation

In the second step, mRNA is translated to amino acids which ultimately form a protein.  Every three mRNA bases is called a codon which codes for one amino acid. Translation always starts with a start codon (AUG) which codes for the amino acid methionine. There are three stop codons (UAA, UAG, and UGA) which signal translation to stop. The rest of the codons code for the different amino acids. More than one codon can code for a single amino acid (as there are 61 codons and only 21 amino acids). Translation happens in the ribosome and involves tRNA. On one side of the tRNA is an anticodon which complementary binds to the mRNA codon, and on the other is a bound amino acid for that specific codon. As the mRNA makes its way through the ribosome the tRNA molecules bind to the mRNA codons and the amino acids from sequential tRNA get bound together in a polypeptide chain. Read this Nature Education article for more specifics on translation.

​

Codon charts such as the one below can be used to identify what amino acid is coded for my a three mRNA base codon. In this type of chart you start from the inside and work outward - i.e. the first base is in the center and the third base is along the parameter. 

Codon_usage.png

[2]​

​

Q3: Using the codon table, what amino acids are at the beginning of the LspA protein from the mRNA sequence you determined in Q2? (hint: I have given you 12 bases so there should be 12/3=4 amino acids)

​

When we are working in the lab we use DNA sequences that are hundreds of bases long. For these it is impractical to use a codon chart, so instead we use online programs such as ExPASy Translate.

​

Q4: Use this tool to determine the full length amino acid sequence for LspA given the DNA sequence:

​

ATGCCGGATGTGGATCGTTTTGGCCGTCTGCCGTGGCTGTGGATTACCGTTCTGGTTTTTGTTCTGGATCAGGTTAGCAAAGCCTTTTTCCAGGCCGAACTGAGCATGTATCAGCAGATTGTGGTTATTCCGGATCTGTTTAGTTGGACCCTGGCCTATAATACCGGCGCCGCATTTTCATTTCTGGCAGATAGCAGCGGTTGGCAGCGCTGGCTGTTTGCACTGATTGCCATTGTGGTTAGTGCAAGCCTGGTTGTTTGGCTGAAACGCCTGAAAAAAGGCGAAACCTGGCTGGCCATTGCCCTGGCCCTGGTGCTGGGCGGTGCATTAGGCAATCTGTATGATCGTATGGTTCTGGGCCATGTTGTGGATTTTATTCTGGTTCATTGGCAGAATCGCTGGTATTTTCCGGCATTCAATCTGGCAGATTCAGCCATTACCGTTGGTGCCGTGATGCTGGCACTGGATATGTTTCGCAGCAAAAAATCTGGCGAAGCCGCCCATGGC

​

Now that you have learned about transcription and translation, watch this video from Cold Spring Harbor Laboratory to see the molecular machinery that carries out these processes.

​

This week in group meeting we will be having a journal club about mRNA vaccines - a hot topic because they are being developed for coronavirus, and it fits in well with our lesson this week. It will helpful to first read this National Geographic article about mRNA vaccines that is geared toward a more lay audience. Then, read this pre-print scientific article and prepare to discuss with the group! (Do not worry about the materials and methods- they used a lot of different techniques! Focus on the figures. PBS (seen in almost all the figures) is a saline solution that is used as a negative control)

[1] "File:Genetic code.svg" by Madprime is licensed under CC BY-SA 3.0

[2] "File:Codon usage bias in P. patens.png" by Manuel Hiss, Lucas Schneider, Christopher Grosche, Melanie Barth, Christina Neu, Aikaterini Symeonidi, Kristian Ullrich, Pierre-François Perroud, Mareike Schallenberg-Rüdinger, Stefan Rensing is licensed under CC BY 4.0

© 2020 by The Columbus Lab. Proudly created with Wix.com

bottom of page